• Live Feeds
    • Press Releases
    • Insider Trading
    • FDA Approvals
    • Analyst Ratings
    • Insider Trading
    • SEC filings
    • Market insights
  • Analyst Ratings
  • Alerts
  • Subscriptions
  • Settings
  • RSS Feeds
Quantisnow Logo
  • Live Feeds
    • Press Releases
    • Insider Trading
    • FDA Approvals
    • Analyst Ratings
    • Insider Trading
    • SEC filings
    • Market insights
  • Analyst Ratings
  • Alerts
  • Subscriptions
  • Settings
  • RSS Feeds
PublishGo to App
    Quantisnow Logo

    © 2025 quantisnow.com
    Democratizing insights since 2022

    Services
    Live news feedsRSS FeedsAlertsPublish with Us
    Company
    AboutQuantisnow PlusContactJobsAI superconnector for talent & startupsNEWLLM Arena
    Legal
    Terms of usePrivacy policyCookie policy

    SEC Form 424B3 filed by Frequency Therapeutics Inc.

    1/9/24 9:02:50 AM ET
    $FREQ
    Biotechnology: Pharmaceutical Preparations
    Health Care
    Get the next $FREQ alert in real time by email
    424B3 1 d466614d424b3.htm 424B3 424B3

    Filed Pursuant to Rule 424(b)(3)

    Registration No. 333-275353

    Prospectus Supplement No. 1

    (to Prospectus dated December 22, 2023)

     

    LOGO

    Up to 1,714,570 Shares of Common Stock

    This prospectus supplement supplements the prospectus, dated December 22, 2023, or the Prospectus, which forms a part of our registration statement on Form S-1 (No. 333-275353). This prospectus supplement is being filed to update and supplement the information in the Prospectus with the information contained in our Current Report on Form 8-K filed with the Securities and Exchange Commission on January 9, 2024, or the Current Report. Accordingly, we have attached the Current Report to this prospectus supplement.

    The Prospectus and this prospectus supplement relate to the proposed offer and resale or other disposition from time to time by the selling stockholders identified in this prospectus of up to an aggregate of 1,714,570 shares of common stock, par value $0.001 per share, of Korro Bio, Inc.

    We are registering the resale of the shares of common stock pursuant to the selling stockholders’ registration rights under a registration rights agreement between us and the selling stockholders. Our registration of the resale of the shares of common stock covered by this prospectus does not mean that the selling stockholders will offer or sell all or any of the shares of common stock. The selling stockholders may offer, sell or distribute all or a portion of their shares of common stock from time to time directly or indirectly through one or more underwriters, broker-dealers or agents, and in one or more public or private transactions. The shares of common stock may be sold in one or more transactions at fixed prices, at prevailing market prices at the time of the sale, at varying prices determined at the time of sale or at negotiated prices. These sales may be effected in transactions, which may involve crosses or block transactions. See the section entitled “Plan of Distribution” for more information.

    We will not receive any proceeds from any sale of common stock by the selling stockholders pursuant to this prospectus. We have agreed to bear the expenses in connection with the registration of the resale of the shares of common stock to be offered by this prospectus by the selling stockholders other than any underwriting discounts and commissions or transfer taxes relating to the sale of common stock, which will be borne by the selling stockholders.

    We are an “emerging growth company” as defined under the federal securities laws and, as such, have elected to comply with certain reduced public company reporting requirements for this prospectus and our other filings with the Securities and Exchange Commission.

    Our common stock is listed on the Nasdaq Capital Market, or Nasdaq, under the symbol “KRRO.” On January 5, 2024, the closing price for our common stock, as reported on Nasdaq, was $50.49 per share.

     

     

    See the section entitled “Risk Factors” beginning on page 5 of this prospectus to read about factors you should consider before buying our securities.

    Neither the Securities and Exchange Commission nor any state securities commission has approved or disapproved of these securities or determined if this prospectus is truthful or complete. Any representation to the contrary is a criminal offense.

    The date of this prospectus supplement is January 9, 2024


     

    UNITED STATES

    SECURITIES AND EXCHANGE COMMISSION

    Washington, D.C. 20549

     

     

    FORM 8-K

     

     

    CURRENT REPORT

    Pursuant to Section 13 OR 15(d) of The Securities Exchange Act of 1934

    Date of Report (Date of earliest event reported): January 9, 2024

     

     

    Korro Bio, Inc.

    (Exact name of registrant as specified in its charter)

     

     

     

    Delaware   001-39062   47-2324450
    (State or other jurisdiction
    of incorporation)
      (Commission
    File Number)
      (IRS Employer
    Identification
    No.)

     

    One Kendall Square, Building 600-700, Suite 6-401, Cambridge, MA   02139
    (Address of principal executive offices)   (Zip Code)

    Registrant’s telephone number, including area code: (617) 468-1999

     

     

    Check the appropriate box below if the Form 8-K filing is intended to simultaneously satisfy the filing obligation of the registrant under any of the following provisions:

    ☐ Written communications pursuant to Rule 425 under the Securities Act (17 CFR 230.425)

    ☐ Soliciting material pursuant to Rule 14a-12 under the Exchange Act (17 CFR 240.14a-12)

    ☐ Pre-commencement communications pursuant to Rule 14d-2(b) under the Exchange Act (17 CFR 240.14d-2(b))

    ☐ Pre-commencement communications pursuant to Rule 13e-4(c) under the Exchange Act (17 CFR 240.13e-4(c))

    Securities registered pursuant to Section 12(b) of the Act:

     

    Title of each class

     

    Trading
    Symbol(s)

     

    Name of each exchange on which registered

    Common stock, par value $0.001 per share   KRRO   The Nasdaq Capital Market

    Indicate by check mark whether the registrant is an emerging growth company as defined in Rule 405 of the Securities Act of 1933 (§230.405 of this chapter) or Rule 12b-2 of the Securities Exchange Act of 1934 (§240.12b-2 of this chapter).

    Emerging growth company ☒

    If an emerging growth company, indicate by check mark if the registrant has elected not to use the extended transition period for complying with any new or revised financial accounting standards provided pursuant to Section 13(a) of the Exchange Act. ☐


    Item 8.01.

    Other Events.

    On January 9, 2024, Korro Bio, Inc. updated its corporate presentation for use in meetings with investors, analysts and others. A copy of the corporate presentation is filed as Exhibit 99.1 to this Current Report on Form 8-K and is incorporated by reference into this Item 8.01.

     

    Item 9.01.

    Financial Statements and Exhibits.

    (d) Exhibits

     

    Exhibit
    No.
      

    Description

    99.1    Corporate Presentation of Korro Bio, Inc., dated January 9, 2024.
    104    Cover Page Interactive Data File (embedded within the Inline XBRL document).


    SIGNATURES

    Pursuant to the requirements of the Securities Exchange Act of 1934, the registrant has duly caused this report to be signed on its behalf by the undersigned hereunto duly authorized.

     

        KORRO BIO, INC.
    Date: January 9, 2024     By:  

    /s/ Ram Aiyar

        Name:   Ram Aiyar
        Title:   President and Chief Executive Officer


    Exhibit 99.1 J . P . M o r g a n H e a l t h c a r e C o n f e r e n c e Edit the Message, Rewrite the Future January 2024 1


    Disclaimers Forward-Looking Statements Certain statements in this Presentation may constitute “forward-looking statements”. Forward-looking statements include, but are not limited to, express or implied statements regarding expectations, hopes, beliefs, intentions or strategies of Korro Bio, Inc. (Korro) regarding the future including, without limitation, express or implied statements regarding: Korro’s RNA editing technology and the benefits of OPERA; the market opportunity for KRRO-110 and potential benefits over other alpha-1 anti-trypsin deficiency (AATD) modalities; the potential of KRRO-110 to be a best-in-class drug candidate for AATD; the potential safety and efficacy of KRRO-110; Korro’s expected cash runway and plans for discovery and preclinical studies, as well as clinical trials, including timing of regulatory filings and data readouts and other developments or results in connection therewith. In addition, any statements that refer to projections, forecasts, or other characterizations of future events or circumstances, including any underlying assumptions, are forward-looking statements. The words “anticipate,” “believe,” continue,” “ could,” “estimate,” “ expect,” “ intend,” “may,” “might,” “plan,” “possible,” “potential,” “predict,” “project,” “ should,” “ strive,” “would,” “aim,” “target,” “commit,” and similar expressions may identify forward-looking statements, but the absence of these words does not mean that statement is not forward looking. Forward-looking statements are based on current expectations and assumptions that, while considered reasonable are inherently uncertain. New risks and uncertainties may emerge from time to time, and it is not possible to predict all risks and uncertainties. Factors that may cause actual results to differ materially from current expectations include, but are not limited to, various factors beyond management’s control including risks inherent in biopharmaceutical development; risks associated with pre-clinical studies and clinical trials; and other risks associated with obtaining regulatory approvals and protecting intellectual property; as well as risks associated with general economic conditions; the inability to recognize the anticipated benefits of the recently completed merger, which may be affected by, among other things, competition, Korro’s ability to grow and manage growth profitably, maintain relationships with customers and suppliers and retain key employees; costs related to merger; the possibility that Korro may be adversely affected by other economic, business, and/or competitive factors; other risks and uncertainties indicated from time to time in Korro’s filings with the SEC, including in Exhibit 99.2 to its Current Report on Form 8-K filed with the SEC on November 6, 2023, as such may be amended or supplemented by its other filings with the SEC. Nothing in this Presentation should be regarded as a representation by any person that the forward-looking statements set forth herein will be achieved or that any of the contemplated results of such forward-looking statements will be achieved. You should not place undue reliance on forward-looking statements in this Presentation, which speak only as of the date they are made and are qualified in their entirety by reference to the cautionary statements herein. Korro does not undertake or accept any duty to release publicly any updates or revisions to any forward-looking statements to reflect any change in their expectations or in the events, conditions or circumstances on which any such statement is based. This Presentation does not purport to summarize all of the conditions, risks and other attributes of an investment in Korro. Industry and Market Data Certain information contained in this Presentation relates to or is based on studies, publications, surveys and Korro’s own internal estimates and research. In this Presentation, Korro relies on, and refers to, publicly available information and statistics regarding market participants in the sector in which Korro competes and other industry data. Any comparison of Korro to any other entity assumes the reliability of the information available to Korro. Korro obtained this information and statistics from third-party sources, including reports by market research firms and company filings. In addition, all of the market data included in this Presentation involve a number of assumptions and limitations, and there can be no guarantee as to the accuracy or reliability of such assumptions. Finally, while Korro believes its internal research is reliable, such research has not been verified by any independent source and neither Frequency nor Korro has independently verified the information. Trademarks This Presentation may contain trademarks, service marks, trade names and copyrights of other companies, which are the property of their respective owners. Solely for convenience, some of the trademarks, service marks, trade names and copyrights referred to in this Presentation may be listed without the TM, SM © or ® symbols, but Frequency and Korro will assert, to the fullest extent under applicable law, the rights of the applicable owners, if any, to these trademarks, service marks, trade names and copyrights. 2


    Uniquely Positioned to Expand the Frontiers of Genetic Medicines through RNA Editing Built an experienced team with a proven track record in genetic medicines TM Built an oligonucleotide-based approach (OPERA ) to affect a single base edit on RNA (efficient, specific and transient) Nominated a candidate (KRRO-110) for alpha-1 antitrypsin deficiency (AATD) with potential for best-in-class profile Continuing to build a unique, wholly-owned pipeline with broad opportunities in rare and common diseases Strong balance sheet with cash runway into ’26 enabling a potential interim clinical readout for 1,2 AATD in 2H ‘25 1 Subject to submission of an Investigational New Drug (IND) application to the U.S. Food and Drug Administration (FDA) or similar application with regulatory agencies in other geographies and subsequent authorization to proceed 3 2 Korro Bio closed reverse merger and financing transaction on 11/3/23 with cash, cash equivalents and short-term investments of approximately $170.0 million


    Create Transformative Genetic Medicines for Diseases with High Prevalence A transient and reversible way to edit RNA (A-to-I edit) using an endogenous editor Expanding the genetic medicines tool-kit by providing an “activation” approach Key internal discoveries driving the potential to develop multiple drug candidates Initial focus on unique opportunities in rare liver and CNS indications 4


    Causal Missense Variants Have Been Identified in Both Rare and Common Diseases * Need for an approach to transiently edit variants to modify biology and alleviate pathology * Adapted from Nature Volume 577, pages 179–189 (2020) 5


    RNA Editing: Transiently Effecting an A-to-I Edit on RNA Using an Oligonucleotide Harnessing an endogenous editing enzyme, ADAR, that is ubiquitously 1 Non-viral intracellular delivery of expressed in all human cells Korro oligo designed to edit a specific adenosine on the target RNA 2 Oligo-RNA duplex recruits adenosine deaminase acting on RNA (ADAR) 4 mRNA translated to 3 ADAR catalyzes protein with ‘I’ read as ‘G’ deamination: ‘A’ to ‘I’ edit Resultant 5 therapeutic protein ADAR ADAR DNA with disease- Adenosine Inosine causing mutation Target RNA 6


    OPERA: Our Differentiated Approach for RNA Editing Deep understanding Expertise in of ADAR biology oligonucleotide chemistry Machine learning optimization Fit-for-purpose delivery of oligonucleotides 1 Comprehensive IP portfolio with 32 patent families covering Korro platform technology and editing strategies 1 IP estate count as of September 18, 2023 for Korro technology (excludes legacy Frequency Therapeutics IP) 7


    Broad and Versatile Opportunity to Impact Biology and Potentially Bring Multiple Therapeutic Options to Patients DNA Pre-mRNA mRNA Polypeptide (Protein) TRANSCRIPTION PROCESSING TRANSLATION Edit a single A-to-I Edit a single A-to-I Current Modifying gene expression • Repair a G->A mutation to correct the protein Focus • Generate a de novo protein with preferred properties (can alter 12 amino acid sequences) 8


    Wholly-Owned Pipeline with Multiple High-Value Targets PROGRAM / PRECLINICAL WHOLLY CONCEPT DISCOVERY PHASE 1 PHASE 2 PHASE 3 INDICATION DEVELOPMENT OWNED? KRRO-110 Repairing a 1 FIH-enabling regulatory filing expected 2H’24 AAT Alpha-1 antitrypsin pathogenic variant deficiency Repairing a Parkinson’s LRRK2 pathogenic variant disease De novo protein Amyotrophic TDP43 to disrupt aggregation lateral sclerosis De novo protein Subsets of pain Na 1.7 v to modulate currents 1,2 Cash runway into ’26 enabling a potential interim clinical readout for AATD in 2H ‘25 1 Subject to submission of an Investigational New Drug (IND) application to the U.S. Food and Drug Administration (FDA) or similar application with regulatory agencies in other geographies and subsequent authorization to proceed 9 2 Korro Bio closed reverse merger and financing transaction on 11/3/23 with cash, cash equivalents and short-term investments of approximately $170.0 million


    OPERA: Our Approach 10


    TM Customized High-fidelity Oligonucleotides for RNA Deamination (CHORD ) Designed to have… High target efficiency CHORD High target specificity Computational efficiency Leveraging chemistry Gen 1.0: A single-stranded, anti-sense Leveraging delivery oligonucleotide RNA editor 11


    High Efficiency: Ability to Potentially Target Any “A” of Interest on Any Transcript 1 Primary Mouse Hepatocytes Patient-derived Neuroblastoma Cells >45% editing achieved >80% editing achieved 100 100 80 80 60 60 40 40 20 20 0 0 SERPINA1 RAB7A UGP2 ACTB UGP2 ACTB RAB7A TDP43 1 SERPINA1 data is from PiZ primary mouse hepatocytes and ACTB, RAB7, and UGP2 data is from wild-type primary mouse hepatocytes (PMH) 12 Editing (%) Editing (%)


    High Specificity: CHORDs Do Not Interfere with Endogenous ADAR Activity in Preclinical Mouse Models Endogenous site: COG Endogenous site: COPA Endogenous site: AJUBA 100 100 100 80 80 80 60 60 60 40 40 40 20 20 20 0 0 0 No oligo KB-7102 KB-7657 No oligo KB-7102 KB-7657 No oligo KB-7102 KB-7657 Note: KB-7102 -Target: Rab7; KB-7657 – Target SERPINA1 Ref: Edits on serotonin receptor lead to 24 different isoforms: Brenda Bass et. al. Nature Comm. 2011; 2: 319.; COG & COPA are edited by ADAR2 primarily. Tenen, D. J. et. al. Blood 2023; 141; 3078, 13 AJUBA is edited by ADAR1 only, Jin Billy Li et. al. Nature Comm. 2021;12: 2165 Editing (%) Editing (%) Editing (%)


    Computational Efficiency: Machine Learning-Driven Identification of CHORDs Across Targets Modification favored = New Mod Edit site Oligo models built through deep learning models 3’ 5' 5’ 3' Modification disfavored Chemically modified RNA 5’ 3’ Template oligo design 100 80 Replicated for multiple 60 targets and sequences at 40 baseline pre-optimization 20 0 ACTB UGP2 SERPINA1 Note: ACTB and UGP2 data from primary mouse hepatocytes (PMH); SERPINA1 data from hepatocyte like cells (zzHLCs) 14 Editing (%)


    Leveraging Chemistry: Structural Biology Insights Enable Potency Boosts In Vivo CHORD and target mRNA New chemistry introduces Significant improvement in editing complexed with ADAR improved potency in vivo in C57BL/6 mouse* 100 Day 1 Day 4 80 Potency increase with 60 new analog 40 20 0 Control KB-9873 KB-7532 *3mg/kg oligo formulated in MC3 LNP injected IV 15 Editing (%)


    Leveraging Delivery: Fit-for-Purpose Based on Target Product Profile GalNAc (ACTB) MC3-LNP (RAB7A) 10mg/kg (QDx5); SC administration 2mg/kg (single dose); IV administration 100 100 KB-9775 KB-2330 KB-4740 80 80 60 60 40 40 20 20 0 0 7 14 1 7 14 Days post last dose Days post last dose Note: GalNAc and LNP data from C57BL/6 mice, N=3/group 16 Editing (%) Editing (%)


    Alpha 1 Anti-trypsin Deficiency (AATD) Delivering a Potential Best-in-Class Candidate 17


    AATD Caused by a Single Missense (G-to-A) Mutation in SERPINA1 Gene in the Liver M-AAT MM Genotype Normal levels of Inhibits neutrophil (normal liver and lung) M-AAT secreted elastase in the lung Z-AAT* ZZ Genotype Reduced levels of Minimal inhibition (fibrotic liver and decreased lung function) Z-AAT secreted of lung neutrophil elastase Mutated AAT polymerizes and aggregates in liver cells ~100K PiZZ adult patients in U.S.** Note: AAT protein is encoded by the gene SERPINA1. The E342K mutation (G to A) in SERPINA1 (Z allele) is the most frequent mutation and causes severe lung and liver disease *Z-AAT not as active as M-AAT 18 **Source: Alpha-1 Foundation. Numbers reflected here are carrier of ZZ genotypes


    Focused on Increasing AAT levels in ZZ Patients to Between MM and MZ Levels Serum AAT levels (μM) = Median AAT for genotype 50 40 100% editing 30 Korro's goal for median editing has potential to reduce lung and liver risk 50% editing 20 Linear relationship with 10 total AAT and genotype 0 1 Odds Ratio MM MZ ZZ 2 COPD 1.0 1.0 8.8 Cirrhosis 1.0 1.5 7.8 1 Nakanishi T. et al. Eur Respir J. 2020 Dec 10;56(6):2001441 19 2 Chronic obstructive pulmonary disease


    KRRO-110 Designed to Correct the Pathogenic Z-AAT Protein to M-AAT Protein in Preclinical Models Endogenous ADAR CHORD SERPINA1 mRNA Human KRRO-110 Liver Editing I A IV DELIVERY Edited SERPINA1 Remaining mutant SERPINA1 CHORD encapsulated in an LNP M-AAT Secreted Z-AAT Secreted Note: Editing is a function of number of transcripts in each cell 20 Hepatocyte


    KRRO-110 Demonstrated >50% Editing in In Vitro Systems with the Z Genotype 1 2 Editing in hepatocyte like cells (HLCs) Editing in human MZ hepatocytes KRRO-110 Transfection +IFN KRRO-110 uptake 100 100 80 80 60 40 60 20 40 0 1 10 100 10 100 1000 10000 Concentration (nM) Concentration (nM) Note: Data represented as average values +/- SEM 1 HLCs derived from ZZ patient, transfected with RNAiMAX with 1U/uL of IFN, editing measured 48-hours post transfection via amplicon-seq 21 2 Primary hepatocytes from MZ donor, free-uptake of LNP, editing measured 48-hours post uptake via amplicon-seq Editing (%) Editing (%)


    Negligible In Vitro Cis Off-Target Editing Observed for KRRO-110 in MZ Hepatocytes MZ Primary Human Hepatocytes* KRRO-110 uptake 100 0 nM Editing at E342K site 25 nM 250 nM 2000 nM 80 60 Baseline E342K Allele 40 20 0 ACCTATGATCTGAAGAGCGTCCTGGGTCAACTGGGCATCACTAAGGTCTTCAGCAATGGGGCTGACCTCTCCGGGGTCACAGAGGAGGCACCCCTGAAGCTCTCCAAGGCCGTGCATAAGGCTGTGCTGACCATCGACAAGAAAGGGACTGAAGCTGCTGGGGCCATGTTTTTAGAGGCCATACCCATGTCTATCCCCCCCGAGGTCAAGTTCAACAAACCCTTTGTCTTCTTAATGATTGAA Background levels SERPINA1 transcript *Note: Each data point represents one experimental replicate with statistically significant editing above sequencing error 22 Editing (%)


    Achieved >50% Editing in Human Transgenic Mouse Model of Z Genotype with a Single Dose Study design Editing in NSG-PiZ mouse KRRO-110; 2mg/kg (single dose) 100 0 1 2 3 4 5 6 7 8 9 Week 80 NSG-PiZ Week 1 Week 9 mouse Results Results 60 I.V. 40 20 0 Control Week 1 Week 9 Well-tolerated in mice toxicity studies at 5 mg/kg Note: Data represented as average values (n=3) +/- SEM 23 Similar results obtained in C57BL/6-PiZ mice licensed from Dr. Jeff Teckman Editing (%)


    AAT concentration (μg/mL) Secretion of Functional AAT (~50uM) as Early as 7 Days Post-Single Dose NSG-PiZ mice elastase inhibition Serum human-AAT concentration KRRO-110; 2mg/kg (single dose) KRRO-110; 2mg/kg (single dose) 60 3240 Total AAT protein 3000 M-AAT 50 2500 40 25 2000 1500 0 20 1000 500 -25 0 0 Control 2 mg/kg Control 2 mg/kg Control 2 mg/kg Control 2 mg/kg Week 1 Week 9 Week 1 Week 9 Note: Data represented as average values (n=3) +/- SEM 24 * Positive control human serum inhibits the human neutrophil elastase AAT concentration (μM) % Elastase Inhibition (compared to baseline)


    Editing De Novo Adenosine on Cyno SERPINA1 to Elucidate Editing in Higher Species Utility in PiZ mouse E342K target site for KRRO-110 Edited (M-AAT) protein detected A >98% homology SERPINA1 transcript of human ADAR A and cyno ADAR Surrogate target site to induce Utility in PiZ mouse and in NHPs amino acid change for KB-1494-GVT1 Edited protein detected (different construct with similar chemistry) 25


    Editing at Surrogate Target Site in AATD Mouse Model Translated to Higher Species Editing in C57BL/6-PiZ mice (%) Editing in NHPs (%) 2mg/kg (single dose) 2mg/kg (single dose) 2mg/kg (single dose) 100 100 KB-1494-GVT1 KB-1494-GVT1 80 80 60 60 40 40 20 20 0 0 Day 4 Day 14 Day 5 Day 15 Surrogate Target Site: SERPINA1 Surrogate Target Site: SERPINA1 Note: Data represented as average values +/- SEM 26 Editing (%) Editing (%)


    KRRO-110 Has Potential for Best-in-Class Profile for AATD Patients Efficacy Safety Translation to higher species ✓ Achieved AAT levels ✓ No off-target effect ✓ Ability to edit in human cells between MM and MZ in observed to date ✓ Translation to NHP with rodents as early as ✓ No effect on endogenous surrogate oligo Week 1 ADAR activity observed ✓ Secreted functional AAT to date and inhibits neutrophil ✓ Well tolerated in non-GLP elastase safety studies (mice, NHP) ✓ Rapid reduction in Z-aggregates and Z-AAT protein 1 Preclinical data package supports goal to submit regulatory filing in 2H 2024 and enable FIH study 1 Subject to submission of an Investigational New Drug (IND) application to the U.S. Food and Drug Administration (FDA) or similar application with regulatory agencies in other geographies and subsequent authorization to proceed 27


    Creating De Novo Proteins Going Beyond “Repairing a Single Pathogenic Point Mutation 28


    Creating De Novo Protein Variants to Modulate Protein Function Disrupting protein-to- Increasing protein expression / half-life protein interactions Single amino acid changes can have Preventing Disrupting aggregation of pathogenic protein a dramatic effect yet maintaining downstream function protein aggregation on disease biology Modulating Changing electrical activity within ion channels to within physiological levels ion channels 29


    Activation of Transcription Factor (TFX) by Creation of De Novo Protein… In vitro editing of normal Downstream target gene TFX variant rescues Hep3B-CYP2E1 1 2 3 TFX in Hep3B cells expression in vivo in mouse liver cells from cytotoxicity 60 15 100 KB-3066 KB-1572 80 40 10 60 40 20 5 20 0 0 0 Cells KB-3066 Cells KB-3066 Cells KB-3066 Control KB-1572 KB-1594 1.56 3.13 6.25 12.5 25 only only +EtOH only +EtOH Concentration (nM) +EtOH +EtOH +TNFa +TNFa 1 Hep3B cells transfected with RNAiMAX at the indicated concentrations with two targeting oligos, editing measured 48-hours post transfection via amplicon-seq 2 Wild type mice dosed with LNP-targeting oligos at a concentration of 3 mg/kg, gene expression measured via quantitative PCR from liver harvested 1 day post dose 30 3 Hep3B-CYP2E1 cells transfected with RNAiMAX at the indicated concentrations with two targeting oligos, cell viability measured 48-hours post transfection via CellTiter-Fluor Cell Viability Assay from Promega % Editing Fold change % Dead Cells


    …and Sustained Downstream Activity in NHPs Lasting Longer than 21 Days Editing in liver cores (Day 3) Presence of TFX variant (Day 3) Durable presence of TFX variant (Day 21) 2mg/kg; QWx3 2mg/kg; QWx3 2mg/kg; QWx3 30 30 30 20 20 20 10 10 10 0 0 0 Control KB-1572 KB-1594 Control KB-1572 KB-1594 Control KB-1572 KB-1594 Durable presence of protein variant correlates with sustained downstream expression of biomarker* *More expansive dataset not shown 31 % Editing Relative Abundance Relative Abundance


    The Team 32


    Experienced Management Team with Proven Track Record Ram Aiyar, PhD Steve Colletti, PhD Vineet Agarwal Todd Chappell Shelby Walker Stephanie Engels Venkat Krishnamurthy, PhD Chief Executive Officer Chief Scientific Officer Chief Financial Officer Chief Operating Officer SVP, General Counsel SVP, HR People SVP, Head of Platform and Culture 33


    Board of Directors with Strong Development and Management Expertise Nessan Rachel Meyers, Ph.D. Timothy Pearson Jean-Francois Ali Behbahani, M.D. David Lucchino Ram Aiyar, Ph.D. Bermingham, Ph.D. Experienced operator in CEO, Carrick Formela, M.D. General Partner, NEA Co-founder, and President and CEO Founder and Executive RNA medicines Therapeutics Founder ex-CEO, Frequency Chairman; Operating Partner, Atlas Venture Therapeutics Partner, Khosla Ventures 34


    Uniquely Positioned to Expand the Frontiers of Genetic Medicines through RNA Editing Built an experienced team with a proven track record in genetic medicines TM Built an oligonucleotide-based approach (OPERA ) to affect a single base edit on RNA (efficient, specific and transient) Nominated a candidate (KRRO-110) for alpha-1 antitrypsin deficiency (AATD) with potential for best-in-class profile Continuing to build a unique, wholly-owned pipeline with broad opportunities in rare and common diseases Strong balance sheet with cash runway into ’26 enabling a potential interim clinical readout for 1,2 AATD in 2H ‘25 1 Subject to submission of an Investigational New Drug (IND) application to the U.S. Food and Drug Administration (FDA) or similar application with regulatory agencies in other geographies and subsequent authorization to proceed 35 2 Korro Bio closed reverse merger and financing transaction on 11/3/23 with cash, cash equivalents and short-term investments of approximately $170.0 million


    Create transformative genetic medicines for diseases with high prevalence 36

    Get the next $FREQ alert in real time by email

    Crush Q1 2026 with the Best AI Superconnector

    Stay ahead of the competition with Standout.work - your AI-powered talent-to-startup matching platform.

    AI-Powered Inbox
    Context-aware email replies
    Strategic Decision Support
    Get Started with Standout.work

    Recent Analyst Ratings for
    $FREQ

    DatePrice TargetRatingAnalyst
    2/15/2023Buy → Neutral
    Chardan Capital Markets
    2/13/2023Outperform → Market Perform
    Cowen
    9/22/2021$12.00 → $9.00Buy → Neutral
    Goldman Sachs
    More analyst ratings

    $FREQ
    SEC Filings

    View All

    SEC Form 424B3 filed by Frequency Therapeutics Inc.

    424B3 - Korro Bio, Inc. (0001703647) (Filer)

    1/9/24 9:02:50 AM ET
    $FREQ
    Biotechnology: Pharmaceutical Preparations
    Health Care

    Frequency Therapeutics Inc. filed SEC Form 8-K: Other Events, Financial Statements and Exhibits

    8-K - Korro Bio, Inc. (0001703647) (Filer)

    1/9/24 9:00:59 AM ET
    $FREQ
    Biotechnology: Pharmaceutical Preparations
    Health Care

    SEC Form EFFECT filed by Frequency Therapeutics Inc.

    EFFECT - Korro Bio, Inc. (0001703647) (Filer)

    12/26/23 12:15:11 AM ET
    $FREQ
    Biotechnology: Pharmaceutical Preparations
    Health Care

    $FREQ
    Press Releases

    Fastest customizable press release news feed in the world

    View All

    $FREQ
    Insider Trading

    Insider transactions reveal critical sentiment about the company from key stakeholders. See them live in this feed.

    View All

    NorthStar Appoints Peter Pfreundschuh to Board of Managers

    NorthStar Medical Technologies, LLC, parent company of NorthStar Medical Radioisotopes, LLC, a global innovator in development, production and commercialization of radiopharmaceuticals used to detect and treat cancer and other serious diseases, today announced the appointment of Peter (Pete) Pfreundschuh to its Board of Managers, effective April 1, 2024. Following this appointment, the Board will comprise of 9 directors, 6 of whom are non-executive. "We are pleased to welcome Pete to the NorthStar Board," said Stephen Merrick, Executive Chairman of NorthStar. "Pete has deep experience in the pharmaceutical and biotechnology industry, with extensive knowledge in corporate finance, business

    4/15/24 9:00:00 AM ET
    $FREQ
    $URGN
    $VYGR
    Biotechnology: Pharmaceutical Preparations
    Health Care
    Biotechnology: Biological Products (No Diagnostic Substances)
    Biotechnology: In Vitro & In Vivo Diagnostic Substances

    Korro Bio and Frequency Therapeutics Announce Closing of Merger and Private Placement of $117 Million

    Korro will be focused on advancing a wholly owned portfolio of RNA editing programsPost-transaction cash of approximately $170 million expected to fund operations into 2026Funds multiple potentially value-creating milestones, including advancing its lead product candidate in Alpha-1 antitrypsin deficiency (AATD) through a clinical trialShares to trade on Nasdaq under the ticker "KRRO" commencing on November 6, 2023 CAMBRIDGE, Mass. and LEXINGTON, Mass., Nov. 03, 2023 (GLOBE NEWSWIRE) -- Korro Bio, Inc. (Korro) (NASDAQ:KRRO), a biopharmaceutical company with a mission to discover, develop and commercialize a new class of genetic medicines based on editing RNA, enabling treatment of both r

    11/3/23 12:19:45 PM ET
    $FREQ
    Biotechnology: Pharmaceutical Preparations
    Health Care

    Frequency Therapeutics Provides Business Updates and Second Quarter 2023 Financial Results

    Frequency Therapeutics, Inc. (NASDAQ:FREQ) today announced business updates and financial results for the second quarter ended June 30, 2023. In July, the Company announced that it entered into a definitive merger agreement with Korro Bio, Inc., a leading RNA editing company focused on the discovery and development of novel genetic medicines. After the anticipated consummation of the merger, the combined company will operate under Korro Bio, Inc. with a focus on the advancement of Korro Bio's portfolio of RNA editing programs and will trade on Nasdaq under the ticker symbol "KRRO." The merger is expected to close in the fourth quarter of 2023, subject to approval by Frequency Therapeutics

    8/10/23 4:01:00 PM ET
    $FREQ
    Biotechnology: Pharmaceutical Preparations
    Health Care

    SEC Form 4 filed by Meyers Rachel

    4 - Korro Bio, Inc. (0001703647) (Issuer)

    11/29/23 4:55:57 PM ET
    $FREQ
    Biotechnology: Pharmaceutical Preparations
    Health Care

    SEC Form 3 filed by new insider Meyers Rachel

    3 - Korro Bio, Inc. (0001703647) (Issuer)

    11/29/23 4:53:41 PM ET
    $FREQ
    Biotechnology: Pharmaceutical Preparations
    Health Care

    Lucchino David L. sold $43,573 worth of shares (1,156 units at $37.69), decreasing direct ownership by 5% to 22,150 units (SEC Form 4)

    4 - Korro Bio, Inc. (0001703647) (Issuer)

    11/27/23 8:48:47 PM ET
    $FREQ
    Biotechnology: Pharmaceutical Preparations
    Health Care

    $FREQ
    Analyst Ratings

    Analyst ratings in real time. Analyst ratings have a very high impact on the underlying stock. See them live in this feed.

    View All

    Frequency Therapeutics downgraded by Chardan Capital Markets

    Chardan Capital Markets downgraded Frequency Therapeutics from Buy to Neutral

    2/15/23 10:23:29 AM ET
    $FREQ
    Biotechnology: Pharmaceutical Preparations
    Health Care

    Frequency Therapeutics downgraded by Cowen

    Cowen downgraded Frequency Therapeutics from Outperform to Market Perform

    2/13/23 11:23:43 AM ET
    $FREQ
    Biotechnology: Pharmaceutical Preparations
    Health Care

    Frequency Therapeutics downgraded by Goldman Sachs with a new price target

    Goldman Sachs downgraded Frequency Therapeutics from Buy to Neutral and set a new price target of $9.00 from $12.00 previously

    9/22/21 6:15:51 AM ET
    $FREQ
    Biotechnology: Pharmaceutical Preparations
    Health Care

    $FREQ
    Leadership Updates

    Live Leadership Updates

    View All

    NorthStar Appoints Peter Pfreundschuh to Board of Managers

    NorthStar Medical Technologies, LLC, parent company of NorthStar Medical Radioisotopes, LLC, a global innovator in development, production and commercialization of radiopharmaceuticals used to detect and treat cancer and other serious diseases, today announced the appointment of Peter (Pete) Pfreundschuh to its Board of Managers, effective April 1, 2024. Following this appointment, the Board will comprise of 9 directors, 6 of whom are non-executive. "We are pleased to welcome Pete to the NorthStar Board," said Stephen Merrick, Executive Chairman of NorthStar. "Pete has deep experience in the pharmaceutical and biotechnology industry, with extensive knowledge in corporate finance, business

    4/15/24 9:00:00 AM ET
    $FREQ
    $URGN
    $VYGR
    Biotechnology: Pharmaceutical Preparations
    Health Care
    Biotechnology: Biological Products (No Diagnostic Substances)
    Biotechnology: In Vitro & In Vivo Diagnostic Substances

    Frequency Therapeutics Expands its Clinical Development Team, Adding Expertise in Inner Ear Physiology and Translational Science

    Company Announces Appointment of Jeffery Lichtenhan, Ph.D., to Lead Efforts in Hearing Diagnostics and Measurement; Joins Frequency from Washington University Medical School in St. Louis Frequency Therapeutics, Inc. (NASDAQ:FREQ), a clinical-stage biotechnology company focused on harnessing the body's innate biology to repair or reverse damage caused by a broad range of degenerative diseases, today announced the expansion of its clinical development team with the addition of Jeffery T. Lichtenhan, Ph.D., a leading expert in hearing diagnostics and measurement. Dr. Lichtenhan, an auditory neuroscientist, will help to advance the Company's hearing clinical development programs, including it

    4/13/21 7:00:00 AM ET
    $FREQ
    Biotechnology: Pharmaceutical Preparations
    Health Care

    Frequency Therapeutics Appoints Kevin Franck, Ph.D., as Senior Vice President, Strategic Marketing and New Product Planning

    WOBURN, Mass.--(BUSINESS WIRE)--Frequency Therapeutics, Inc. (Nasdaq: FREQ), a clinical-stage biotechnology company focused on harnessing the body’s innate biology to repair or reverse damage caused by a broad range of degenerative diseases, today announced the appointment of Kevin Franck, Ph.D., as Senior Vice President of Strategic Marketing and New Product Planning. Dr. Franck will lead pre-commercial strategy and launch planning for Frequency’s clinical pipeline, including its lead program aimed at developing a restorative treatment for sensorineural hearing loss (SNHL), the most common form of hearing loss. Dr. Franck is a leader in the hearing field with 25 years of experienc

    2/8/21 7:00:00 AM ET
    $FREQ
    Biotechnology: Pharmaceutical Preparations
    Health Care

    $FREQ
    Financials

    Live finance-specific insights

    View All

    Korro Bio and Frequency Therapeutics Announce Merger Agreement

    Merger to create a Nasdaq-listed genetic medicines company focused on advancing Korro Bio's wholly owned portfolio of RNA editing programs Lead program is a disease modifying therapy for patients with alpha-1 antitrypsin deficiency (AATD), with preclinical data showing an increase of normal A1AT protein to 85% of total protein in circulation  Combined company is expected to have cash balance of approximately $170 million at close, which is expected to provide cash runway through several value-creating milestones and into 2026 Companies to host conference call today at 8:30 a.m. ET Korro Bio, Inc., a leading RNA editing company focused on the discovery and development of novel geneti

    7/14/23 6:30:00 AM ET
    $FREQ
    Biotechnology: Pharmaceutical Preparations
    Health Care

    $FREQ
    Large Ownership Changes

    This live feed shows all institutional transactions in real time.

    View All

    SEC Form SC 13G/A filed by Frequency Therapeutics Inc. (Amendment)

    SC 13G/A - Korro Bio, Inc. (0001703647) (Subject)

    2/14/24 4:57:08 PM ET
    $FREQ
    Biotechnology: Pharmaceutical Preparations
    Health Care

    SEC Form SC 13G/A filed by Frequency Therapeutics Inc. (Amendment)

    SC 13G/A - Korro Bio, Inc. (0001703647) (Subject)

    2/14/24 3:03:45 PM ET
    $FREQ
    Biotechnology: Pharmaceutical Preparations
    Health Care

    SEC Form SC 13G filed by Frequency Therapeutics Inc.

    SC 13G - Korro Bio, Inc. (0001703647) (Subject)

    2/14/24 11:59:09 AM ET
    $FREQ
    Biotechnology: Pharmaceutical Preparations
    Health Care